A resource on hypoxia responsive genes in fish
 
  Primer design
 
Genomic mRNA  primers of the gene LOC103131039 (heme oxygenase 2-like) of species Poecilia formosa
Sub-sequence:  From To    Product range: MinimumMaximum        

Selected sub sequence
Target sequence length: 5631 Selected subsequence from: 1 to:700 Selected subsequence size:700
GAAAGCTGTGTAAAATACAAATATGGAGAAACTATCAGGGTATGAATTATATCATCAATAATCCACGGTTCCACTCTCCTCATTATCATGACTTATCAGGTGTAAATTCCTGTTCTTCTT
TGTGTTTCAACAAGTTCGGCTGATCTGTCTGAGATGTTACTTGCTGGTACCAAGGAGTCCCACACCAAAACCGAGATCTCCCAGCTGGGCAGAGATTTCTACAAAGGGATCGTCAAAAAG
GACGTCCTTAAGGTTTGCTTCCTTTTAAACTGCTGTTGTATGAAATTCTGTTCAAACATTTTCATGATGCTAACTTATAAGGAACCATAGTTATTGAGAAGGTTCTGCTGTTTGTCTCCG
CTCTGGCTCATTAATATCATGGTAAGTCTGTGCTTGATTCTAGAGGAGTCCTTAAGCATCTGGTATTTAGATCTTAGCTTTGGAACCGACGTGCCACAGCTACCCAACCACATTTATTTA
TACATGAATAGTTCCAATGCCAAAGGAACACTTTGGATCCTCTGTGGTAACACCAGTAGGTTTTATATTTTGGCTTAAGCCAGGGTTCGTCCACACATGTCCTAGAATATTTGCGTCTGT
ATGCATTAGGGGTTCACCGATTGCAGCTTTCTGGCCAATCGCCAATCTGCCAACACTGATTTTTAGTATCGGCAGGTCAGGCTGTTTTTTTTTAAATTAT

Primers information
S.No.Primers SequencesStartLengthTm GC %Product size
1Forward primer

Reverse primer

AGTCCCACACCAAAACCGAG

AGCCTGACCTGCCGATACTA

175

682

20

20

60.179

60.106

55.000

55.000

508 bp
2Forward primer

Reverse primer

GAGTCCCACACCAAAACCGA

AGCCTGACCTGCCGATACTA

174

682

20

20

60.179

60.106

55.000

55.000

509 bp
3Forward primer

Reverse primer

TACCAAGGAGTCCCACACCA

AGCCTGACCTGCCGATACTA

167

682

20

20

60.105

60.106

55.000

55.000

516 bp
4Forward primer

Reverse primer

TGGTACCAAGGAGTCCCACA

AGCCTGACCTGCCGATACTA

164

682

20

20

60.105

60.106

55.000

55.000

519 bp
5Forward primer

Reverse primer

GTCCCACACCAAAACCGAGA

AGCCTGACCTGCCGATACTA

176

682

20

20

60.179

60.106

55.000

55.000

507 bp


Home  CABin  Support &Feedback
Copyright ©2016 NBFGR (ICAR), All Rights Reserved