A resource on hypoxia responsive genes in fish
 
  Primer design
 
Genomic mRNA  primers of the gene camk2g (calcium/calmodulin dependent protein kinase II gamma) of species Astyanax mexicanus
Sub-sequence:  From To    Product range: MinimumMaximum        

Selected sub sequence
Target sequence length: 83507 Selected subsequence from: 1 to:700 Selected subsequence size:700
GTGTGCGCGAGACCAGCCTCCCCGAAACCTGAGCGAGGCAGAGGCAGCGAAACGAGAGGCGACAGAGCGCGAGCGCTACCACCACCCTCAGCACAACATGGCTACAATTGCAACCTCGAC
CAGGTTTACAGACGAGTACCAGCTCTACGAGGAGCTCGGAAAGTAAGCGACAGCTGCAGCTGCTGCTGCTGGTTTTGTGTTTGTTTGGTTGTTTATTTGGTCGGATAGTCCGCTCTCCGG
GCTGGTTCTGCGGGTCTGTGTGCTGAGCGGACTGCAGGAGCCGCTGGCTGTCTGTCGCCTGTCAGAAACAGCACGGCAACCAGGAAGCCTGTCTTCACCTTTTAGACCGATAGACAGGTT
AGAGGGCTGTGTGATCTCAGCCCCAGCGCTGCTAGGAGCTGTGTTCATGGTTTATGCTGTTGTTAAATTTGACTGCAAACAGTCGTTAAAACATCGTGTTAGCTCCGCTCCGGCGACCAG
AGCTCTTGAGCCTGCCTGTGTTTTTGTCGTGCCGTGTTCAATAAGGTGGCTGCTGCTCGCTCCAGCCTTCTGAGTGGCCGGTGTTCTGTACAGTCTTGCTACCCATCGATATCTGCTAGG
TGTCAGCACTGCGCATGCGCTAACCTAACATTTATTTTATGCTTTCGTGAGTTTTTTATTTTTAGTTTTGCTTGAGTGCGTTATACAATTTGAGCCTACT

Primers information
S.No.Primers SequencesStartLengthTm GC %Product size
1Forward primer

Reverse primer

CAGAGGCAGCGAAACGAGAG

AGACTGTACAGAACACCGGC

38

575

20

20

61.075

59.683

60.000

55.000

538 bp
2Forward primer

Reverse primer

GAAACGAGAGGCGACAGAGC

AGACTGTACAGAACACCGGC

48

575

20

20

61.074

59.683

60.000

55.000

528 bp
3Forward primer

Reverse primer

AAACGAGAGGCGACAGAGC

AGACTGTACAGAACACCGGC

49

575

19

20

60.080

59.683

57.895

55.000

527 bp
4Forward primer

Reverse primer

CGAAACGAGAGGCGACAGAG

AGACTGTACAGAACACCGGC

47

575

20

20

60.795

59.683

60.000

55.000

529 bp
5Forward primer

Reverse primer

TACCACCACCCTCAGCACAA

AGACTGTACAGAACACCGGC

76

575

20

20

61.057

59.683

55.000

55.000

500 bp


Home  CABin  Support &Feedback
Copyright ©2016 NBFGR (ICAR), All Rights Reserved