Top 10 Barcode Families
Family Species
Cyprinidae[ 160 ]
Serranidae[ 64 ]
Labridae[ 57 ]
Carangidae[ 56 ]
Gobiidae[ 52 ]
Pomacentridae[ 42 ]
Lutjanidae[ 42 ]
Sisoridae[ 35 ]
Blenniidae[ 32 ]
Sciaenidae[ 29 ]
 
Top 10 Fish Barcode Records
Species Specimen
Prionace glauca [ 372]
Thunnus albacares [ 349]
Mugil cephalus [ 337]
Sphyrna lewini [ 318]
Coryphaena hippurus [ 305]
Neotrygon kuhlii [ 302]
Channa striata [ 301]
Oncorhynchus mykiss [ 293]
Galeocerdo cuvier [ 220]
Terapon jarbua [ 208]
Protocol

Protocol for DNA Isolation from fishes

  • To begin with, weigh 50 mg tissue sample in a 1.5 ml eppendorf tube and add 1 ml High-Tris-EDTA buffer. Centrifuge at 10,000 rpm for 10 minutes at 4°C & decant the supernatant. Repeat the step.
  • Add 0.5 ml incubation buffer into the pellet and incubate the eppendorfs at -400C overnight (for efficient homogenization). Homogenize the sample kept at -800C with micro pestle.
  • Add 0.5 ml incubation buffer, 10 mg SDS and 10 µl Proteinase K in each eppendorf.
  • Incubate the sample at 370C overnight in water bath for complete lysis of the tissue.
  • To the overnight lysed sample, add 1 ml incubation buffer, 2 ml Tris-saturated phenol (pH 8.0) & shake slowly for 10 minutes on gel rocker.
  • Add 2 ml Chloroform: Isoamyl alcohol (24:1 v/v) & shake slowly for 10 minutes on rocker & centrifuge tubes at 10,000 rpm for 10 minutes at 200C.
  • Pipette out aqueous phase using wide bore tip and transfer to new eppendorf tube. Add 2 ml Chloroform: Isoamyl alcohol (24:1 v/v) & shake slowly for 10 minutes on gel rocker.
  • Centrifuge tubes at 10,000 rpm for 10 minutes at 200C & pipette out supernatant carefully.
  • Add 1/10 volume of 3M sodium acetate (pH 5.2) and 2.5 volume ice cold absolute ethanol. Keep the tube on ice for one hour.
  • Centrifuge tubes at 10,000 rpm for 10 min. at 40C & decant ethanol carefully without disturbing the pellet. Add 2 ml 70% ice cold ethanol & centrifuge tubes at 10,000 rpm for 10 minutes at 40C.
  • Discard 70% ethanol & invert the tubes to drain off remaining ethanol for 5 minutes and air dry for 30-45 minutes. Add 100 µl TE buffer (pH 8.0) & dislodge pellet from walls of tubes by gently shaking. Store the DNA samples at 40C.
  • For RNase treatment, add 1µl of RNAase (10 mg / ml) & keep sample at 370C in water bath for 2 hours. Store the samples at -200C.

Qualitative and Quantitative estimation of DNA
Estimation of the DNA concentration is performed by agarose gel electrophoresis, 0.7% agarose gels in submarine gel casting units. The qualitative and quantitative estimation is determined through Nanodrop spectrophotometer.
For agarose gel electrophoresis, 0.8% agarose gel is prepared consisting of 8 mg agarose dissolved in 1X TAE, boiled and cooled to room temperature. Further, 2 ml of Ethidium bromide is added and agarose solutions is poured in gel casting plate with already adjusted gel comb and keep it to solidify at room temperature for 45 minutes. Use cold 1X TAE as gel running buffer.
Load 2µl of sample mixed with 0.5µl of loading dye (Bromo-Phenol Blue) in the wells. Run the samples at 70V for 15 to 20 minutes and visualize in ultraviolet light.

PCR amplification
The universal set of primers forward primer (FishF1: TCAACCAACCACAAAGACATTGGCAC and reverse primer (FishR1: TAGACTTCTGGGTGGCCAAAGAATCA) are used for PCR amplification of the mitochondrial genes cytochrome c oxidase I (COI). PCR reaction in a final volume of 50µL includes 10X PCR buffer, 100 µM dNTPs, 2mM MgCl2, 10 picomole of each primer, 3UTaqDNA polymerase and 100 ng template DNA. The reaction mix is subjected to incubation consisting of initial denaturation of 3 minutes at 94°C, followed by 35 cycles of denaturation at 94°C for 1 minute, annealing at 55°C for 45 seconds, extension at 72°C for 80 seconds with final extension at 72°C for 10 minutes.
PCR amplicons are checked for quality on 1% agarose gel stained with ethidium bromide and visualized/documented on gel documentation system (UVP Bio-imaging Systems, USA). Custom sequencing of amplicons were performed following the di-deoxynucleotide chain termination method (Sanger et al. 1977), using automated techniques in ABI 3500 sequencer.

Sequencing PCR
Products were labeled using the BigDye Terminator V.3.1 Cycle sequencing Kit (Applied Biosystems, Inc). Reagent quantity for one sequencing PCR reaction cocktail was Terminator Ready Reaction Mix (2.5X)- 8.0 μL, BigDye Sequencing buffer (5X)- 4.0 μl, PCR product (50 ng/μl)- 1 μl, Primer (3μM)- 1.0 μl (forward in one PCR tube and reverse in other tube), Deionized water- 6.0 μL, make up the final volume to 20 μl.
Cycle sequencing PCR conditions are 96°C for 1 min and then 25 cycles of 96°C for 10 seconds; 50°C for 5 seconds; 60°C for 4 minutes.

Sequencing assemblage/editing
Both Forward (light) and Reverse (heavy) strand sequences are obtained for all the species. Forward strand sequences are generally better than reverse strand. Reverse strand sequences are inverted (reversed and complimented) and aligned with the forward strand sequence. Ambiguities are referenced against the sequencing electropherograms and corrected as per necessity.
Full length sequences are made from forward and reverse strands for all samples of a species and aligned using ClustalW (Thompson et al., 1994). The edited sequences are blasted in NCBI GenBank for the nearest similar sequence matches (Altschul et al., 1990) and submitted to GenBank.

Genetic Distances and Phylogenetic Analysis
The extent of sequence difference between species was calculated by calculating average pairwise comparisons of sequence difference across all individuals. Pairwise evolutionary distance among haplotypes is determined by the Kimura 2-Parameter method (Kimura, 1980) using the software program MEGA4 (Molecular Evolutionary Genetics Analysis) (Tamura et. al., 2007) The first phylogenetic tree is constructed by Neighbor-Joining method (Saitou & Nei, 1987) based on bottom-up clustering & distance between each pair of taxa. The second phylogenetic tree is inferred by Maximum Parsimony (MP) criteria (Eck & Dayhoff, 1966) using the CNI (Close-Neighbor-Interchange algorithm) (Nei & Kumar, 2000). Parsimony methods are based on character values observed for each species, rather than the distances between the sequences. Branch lengths are generally not obtained for each topology; the sequences at each node are inferred to be those that require the least number of changes to give each of the two immediately descendant sequences. Bootstrap values are included to test the reliability of inferred trees (Felsenstein, 1985) and the estimation of evolutionary divergence between sequences is computed. All pairwise distances are analysed using the Kimura 2 Parameter (K2P) method in MEGA4.