A resource on hypoxia responsive genes in fish
 
  Primer design
 
Genomic mRNA  primers of the gene camk2g2 (calcium/calmodulin-dependent protein kinase (CaM kinase) II gamma 2) of species Danio rerio
Sub-sequence:  From To    Product range: MinimumMaximum        

Selected sub sequence
Target sequence length: 121890 Selected subsequence from: 1 to:700 Selected subsequence size:700
TCTCTCTCTCTCTCCACCTCCGCCAACACACACCACTTACCAGCACCTCTCTCTCTTCCTTCTCCCCCACCTCCTCCTTTCTCTCTCTCTCTCTCTCTCTTTCCCTCTGAGTGAGCGAGA
GATCTCCCGAAACCTGAGCGAGGCGCTCCCGGAGACACCACAGAGGCGAAATCCTCGTAAAGCGCAACATGGCTACAATTGTAACCTGCACCAGGTTCACAGACGAATATCAGCTGTACG
AAGAGCTCGGAAAGTAAGCGACCGCACCGCTGCATTTGCGCTCCACACATACACTCTTCTCTCTCTGCATTGTGTCTGATCGTGTGTGTCCTGTGTCTAGTTCGCTGTGTTGACAGCAGC
CTTCACGCGCAGAGGCGTCGCGCTTTTGCATGTCACAAAGCCAGCGCAGCCGCTACAAGAAAGCCCGATTGGGTCTATTTGAGCAGTTCGGTGTATTATAAAGCCTCGGCGGTCACGGAG
CTCGTTTCTTTGTTTATCTTTAGATGCGTTTCCTAACATCGTGCTCGCGCGCTACAGGGTGCTTTCGGAGCCTGCGTGTCGTCGTGATGTAAGGTGTGATACTTTATCGACAGTTTATCG
ACGTTAGTTAGAAAGGGAAATCCTCCACCATGAAGAGGAGTGTTGGGATTTGTGATCCGCGTCTGTGTTTTGAATGCACACCTAAACTTTTACAGCATTC

Primers information
S.No.Primers SequencesStartLengthTm GC %Product size
1Forward primer

Reverse primer

GAGACACCACAGAGGCGAAA

CGCGGATCACAAATCCCAAC

151

660

20

20

59.966

59.901

55.000

55.000

510 bp
2Forward primer

Reverse primer

CACACCACTTACCAGCACCT

TTACATCACGACGACACGCA

28

571

20

20

59.891

60.040

55.000

50.000

544 bp
3Forward primer

Reverse primer

TTCCCTCTGAGTGAGCGAGA

CGCGGATCACAAATCCCAAC

100

660

20

20

59.962

59.901

55.000

55.000

561 bp
4Forward primer

Reverse primer

CACCACAGAGGCGAAATCCT

CGCGGATCACAAATCCCAAC

155

660

20

20

60.036

59.901

55.000

55.000

506 bp
5Forward primer

Reverse primer

ACACACCACTTACCAGCACC

TTACATCACGACGACACGCA

27

571

20

20

60.179

60.040

55.000

50.000

545 bp


Home  CABin  Support &Feedback
Copyright ©2016 NBFGR (ICAR), All Rights Reserved