A resource on hypoxia responsive genes in fish
 
  Primer design
 
Genomic mRNA  primers of the gene hmox1a (heme oxygenase 1a) of species Danio rerio
Sub-sequence:  From To    Product range: MinimumMaximum        

Selected sub sequence
Target sequence length: 6111 Selected subsequence from: 1 to:700 Selected subsequence size:700
CCCTCTCTGCTTTGTCATGAGAAAGCGCTGAGATTTCGCCCAGTCATGTTTAGCTCAGGCATGTGAAACTGGCTCAACATTTTCACTTCCCTTTCCACTAAAAAAACAGTGACTCAGACA
GAGAGGAGAAAGTATAAAAACGAAGTGGGGCGGTCAGGGAGCTCACACAGTCGCAGTGAACACTGAAGACAACGCAAGCTCTTTAATATACAGAAAGAAAGACAGGACATCTACAGCACA
AGTAAGAACATTTGCGATCTCTGTTTAAATCTGAGTCTGCGGAAATGGCGACATTTGATAACAAATAGGGCAATCTGTTTTTTTAGAGATGGACTCCACCAAAAGCAAAGCGGCAGAGAA
CACTGGCAGGTAAAGAAATGCTTTGTTTTATTTATTGTTTAGGCAGAATTTCATAGTGATAAACACTTCATCTGACTGCTCCAGGAAAATCATACCAGATAGTGAGCTACAGGAGTTTCA
ATTGTAGAGATACTGTTGGAGTGTATCTATAGGATAACTGAATTGTCAAAATAATTAAGATTCTTGTGAAATTATATATTTTTTTAAAGTGCTGTTTAACATAGAGAACATTTTATCCCA
TTTGTAAACACAATAGTTAACAACTAATTTCTAGTAACTCATTTATTTTGTCTTTCCTTGATGACTACATACATTTTTCTAGTTATTTTACAAGGGATTA

Primers informationWarning: Flanking regions either do not have much GC contents or pose insufficient length to design primer sequences.

Home  CABin  Support &Feedback
Copyright ©2016 NBFGR (ICAR), All Rights Reserved