A resource on hypoxia responsive genes in fish
 
  Primer design
 
Genomic mRNA  primers of the gene arnt2 (aryl-hydrocarbon receptor nuclear translocator 2) of species Danio rerio
Sub-sequence:  From To    Product range: MinimumMaximum        

Selected sub sequence
Target sequence length: 172496 Selected subsequence from: 1 to:700 Selected subsequence size:700
TTTAGTACACCAAAAAGAGATAAGCTAAGCTAATCCAGCTAAAACAGTGCTTAAAATTTCACCAAATTCAAACCTCATAATTAAATAAAAAAATGTAGTAAATTTGTTGTTATAGCCCCA
AAACTCTGGAACGGGCTTCCACCCCATATTAGACACGCTTTAACTCTATCTGTTTTTAAAAAGCTTCTCAAACAGCATCTTTGTTCTTTAGCATTTGAGCTTTTTTATGTTGAGGGGTTT
GTCTTCTATATTAATTCTTATGTATGTGATGTAGAACTTATTTTAATTAGTATTGATTGTGTTGTAAAAAAATGTGCTATATAAACTAACTAACGACTAATGTTGTCTTACATATTAGTG
ATTTTTCTAATATGCTTACAGTCAAATGCGAAAATTTTTAAATGACCAAATCTGCTTCTGGCAAAAGTCAGACTTCAAACCTGTCAGACAAAATTGAGGTTAAGTTGGTTTTATATACAC
ACATTTTCCTTAATAATATAATTTCTGAAGTATTAATTACAAGTTCCAAACACTAAACTTATTTGACTATAAAAGTACAACAACTTTCACAGTCAAATAAATAGCGCAAATGTTGTTTTG
AAGTAATATTTACATGTAATTTTAGACCGGATACTCAAAGTACCATGGTAAACAATATAGGAAGCATGTGTCACAGGTTGTCCCTGAACGCATGTGCTAA

Primers information
S.No.Primers SequencesStartLengthTm GC %Product size
1Forward primer

Reverse primer

CCCCAAAACTCTGGAACGGG

CACATGCGTTCAGGGACAAC

115

695

20

20

60.894

59.762

60.000

55.000

581 bp
2Forward primer

Reverse primer

CCAAAACTCTGGAACGGGCT

GGACAACCTGTGACACATGC

117

682

20

20

60.537

59.407

55.000

55.000

566 bp
3Forward primer

Reverse primer

CCAAAACTCTGGAACGGGCT

CACATGCGTTCAGGGACAAC

117

695

20

20

60.537

59.762

55.000

55.000

579 bp
4Forward primer

Reverse primer

AGCCCCAAAACTCTGGAACG

GGACAACCTGTGACACATGC

113

682

20

20

60.537

59.407

55.000

55.000

570 bp
5Forward primer

Reverse primer

AGCCCCAAAACTCTGGAACG

CACATGCGTTCAGGGACAAC

113

695

20

20

60.537

59.762

55.000

55.000

583 bp


Home  CABin  Support &Feedback
Copyright ©2016 NBFGR (ICAR), All Rights Reserved