A resource on hypoxia responsive genes in fish
 
  Primer design
 
Genomic mRNA  primers of the gene notch2 (notch receptor 2) of species Danio rerio
Sub-sequence:  From To    Product range: MinimumMaximum        

Selected sub sequence
Target sequence length: 70808 Selected subsequence from: 1 to:700 Selected subsequence size:700
CAGTGACTGGGACGAAAAGAAGAGAGAAGTTCAGAAAGTTTGATCACAGCGCAGCTACGTGAAGAAAAAAACTTTCAAATGAAGTCACTATACGGATTTATGTGGTCAAACGAGACACCC
TGACAGACAAAACACAGCTTCTCCACCGAGTATAATTCGTTTTCCGCGATTTGAAGAGCTTTTTGAGATTCGTGACGCTTTAACCTGACGGAGCTCAGCCTCGCGCTGGCGGCTCTATGT
GGATTTTACTCAAAATATGGGCCAATTACCCGGTGTCTCTTCGGGCGGAGTCATCCTTCTCCTTATTTGCTTTCTCAAAACATCATATGGTAAGTGGTTTAACAGTTTATATATCTGAAC
TCGTTCTTTTAAACCGCTATTTGCCGTCAGTAACGTTACGCATCTGTACGGCGGCGTGAAGCATCAGCGCTCACGTTTCAGTTCTGCACGGCCTCAAATGGCGTGTGTCCGCTCACGTTA
TTGGAAATTGACTAACATAATGAAGTAAAAGATGAGACATATTATTTACGCTTTTGCATAAACATTTAAAAACTCAAAGCTTTTTCCCCCCCGAAGTGAGCTCTCGTGTTTCACACCTCT
GCCCAGATGTGAAAGTCGGCGGATGAAATCTGCAGCGGCTTCCAGTAACTAATGTGAGAGGAGAATTCAAAATGGACACGTATGAGCGGAAAATATGGAC

Primers information
S.No.Primers SequencesStartLengthTm GC %Product size
1Forward primer

Reverse primer

TGTGGTCAAACGAGACACCC

TTCATCCGCCGACTTTCACA

100

626

20

20

60.179

59.966

55.000

50.000

527 bp
2Forward primer

Reverse primer

TGGTCAAACGAGACACCCTG

TTCATCCGCCGACTTTCACA

102

626

20

20

59.894

59.966

55.000

50.000

525 bp
3Forward primer

Reverse primer

TGGTCAAACGAGACACCCTG

TAGTTACTGGAAGCCGCTGC

102

650

20

20

59.894

60.108

55.000

55.000

549 bp
4Forward primer

Reverse primer

AACACAGCTTCTCCACCGAG

TAGTTACTGGAAGCCGCTGC

130

650

20

20

59.966

60.108

55.000

55.000

521 bp
5Forward primer

Reverse primer

GTGGTCAAACGAGACACCCT

TTCATCCGCCGACTTTCACA

101

626

20

20

59.894

59.966

55.000

50.000

526 bp


Home  CABin  Support &Feedback
Copyright ©2016 NBFGR (ICAR), All Rights Reserved