A resource on hypoxia responsive genes in fish
 
  Primer design
 
Genomic mRNA  primers of the gene pparaa (peroxisome proliferator-activated receptor alpha a) of species Danio rerio
Sub-sequence:  From To    Product range: MinimumMaximum        

Selected sub sequence
Target sequence length: 41642 Selected subsequence from: 1 to:700 Selected subsequence size:700
TGTCGGGAGGTGTGCGCTGTGTGTGTCGCGTCCGTGAGTTTCAATGCTGTCAGAGCGGTTTGACAAGCAGGCTTTGCGGTGAATTTTAAACAGGACCGTCCGAGAAGCAGCACAGCCTCC
CTCGCACCGCCGACCTGACCGCTGGCAGTCTCTCAGAGCCCGTGTGTTTCATTCCTGTCCGCATGGCGGCCCGGGATTGGGAGGTAGACGCGCAGCTCTTGTAAACAAAGCGCTTGTGTA
ACAATTATGATCGTGCTTTATCCGCTTTTATGGCCGTGATTGCAGTACTCGTACGCTTTTAACTGGAGCAGAGTAAACATTCACATCAGAACACATGCCTGATATTGTCACCGCGGGCTT
CTCATCGTGTACTCTGATGGCGAAGAATTGCGTTTGCCTTGGGTTTATCAAGATTTTCACTCTTGTTTGAAGCGAAGAGAAACTTTACAGCGTCTGTGTTGCCCTCATACGCACCTTCAT
GCTCTTGTCTTAAGCTTGCTGATTCAGTCAGCGAGTTGGTTGGTTTGTTGACTAGTTGTCTCGCTGTTACATGGAGTTTTCTGCAGAATAGCATACTTTTGTACAAGTAATAACATAATA
ATGCACACATTTATGTAACACTTTAAAAAGTGCACGGTTATAATTATGTATTAATGGTTTAGTTAAGTATGACTTTAAAATGAACTGTGTTTGTTTTACT

Primers information
S.No.Primers SequencesStartLengthTm GC %Product size
1Forward primer

Reverse primer

TCGCGTCCGTGAGTTTCAAT

ACAAACCAACCAACTCGCTG

25

527

20

20

60.319

59.262

50.000

50.000

503 bp
2Forward primer

Reverse primer

TCGCGTCCGTGAGTTTCAAT

AACCAACCAACTCGCTGACT

25

524

20

20

60.319

59.820

50.000

50.000

500 bp
3Forward primer

Reverse primer

GCGTCCGTGAGTTTCAATGC

ACAAACCAACCAACTCGCTG

27

527

20

20

60.453

59.262

55.000

50.000

501 bp
4Forward primer

Reverse primer

CGCGTCCGTGAGTTTCAATG

CAAACCAACCAACTCGCTGA

26

526

20

20

60.179

58.979

55.000

50.000

501 bp
5Forward primer

Reverse primer

CGCGTCCGTGAGTTTCAATG

ACAAACCAACCAACTCGCTG

26

527

20

20

60.179

59.262

55.000

50.000

502 bp


Home  CABin  Support &Feedback
Copyright ©2016 NBFGR (ICAR), All Rights Reserved