A resource on hypoxia responsive genes in fish
 
  Primer design
 
Genomic mRNA  primers of the gene flt1 (fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor recep) of species Danio rerio
Sub-sequence:  From To    Product range: MinimumMaximum        

Selected sub sequence
Target sequence length: 58007 Selected subsequence from: 1 to:700 Selected subsequence size:700
AATTCATGCGCGGTCCTCCTGCTTCAAGAGTTCATACACATTGCGGAAACTAGCTACCGAGATTGACTGTTGTCCCCGTGAACGCAGGGTTTCAGGAGTTTGGCGTTGTGAGGTGAACTG
ATTCTCTGGAGTATTGGATCCGCAGTGTTATATTCCTCCATAGGTATTCCTTCATCTCCAAACAAACACCCTCAAGCAAGACCAAGAGAATGTTCGATATATTATTTGTGATGATATTTG
GACTGTCAGGACGTGTTCTGACTAAAGGTATGTGCTTTATTTTTAAGTGTTTTATTTGTGTTCGTATATAGCCTACAAATAATACATTTATGTATAGTCCATATATTAATTTTAGCTACT
TGTCATTGTATTCAAAATAAGTTCTTGTTTAACACTCATCAAAGTGATGAAATACAGGTCTGGAATGCGCGCGGATGAGAGTGTGGCATTGCTCAGCTCCAGCGCATCTGATACCTAGAA
AAAAACATCCAGAAACTTTGGATGCATATATAAACTTGTTCGCATATCTTTATTTTTAATAAACAATTCAATGGCAATTGAGAGTATGACATAATTGCAAAATTATGCAAGAAATTTGCG
CAAAAAAAATTATTTACTAAAATTTTAGTTTTCCCACTACTATGGCAAGCCGATTTAACATTTATCACAACTATGTACAAATACTAACTGGTTTGCGCTT

Primers information
S.No.Primers SequencesStartLengthTm GC %Product size
1Forward primer

Reverse primer

TGACTGTTGTCCCCGTGAAC

TCGGCTTGCCATAGTAGTGG

63

652

20

20

60.179

59.536

55.000

55.000

590 bp
2Forward primer

Reverse primer

AGTTTGGCGTTGTGAGGTGA

TCGGCTTGCCATAGTAGTGG

96

652

20

20

60.107

59.536

50.000

55.000

557 bp
3Forward primer

Reverse primer

AGTTTGGCGTTGTGAGGTGA

CGGCTTGCCATAGTAGTGGG

96

651

20

20

60.107

60.533

50.000

60.000

556 bp
4Forward primer

Reverse primer

TTGGCGTTGTGAGGTGAACT

TCGGCTTGCCATAGTAGTGG

99

652

20

20

60.107

59.536

50.000

55.000

554 bp
5Forward primer

Reverse primer

TTGGCGTTGTGAGGTGAACT

CGGCTTGCCATAGTAGTGGG

99

651

20

20

60.107

60.533

50.000

60.000

553 bp


Home  CABin  Support &Feedback
Copyright ©2016 NBFGR (ICAR), All Rights Reserved