A resource on hypoxia responsive genes in fish
 
  Primer design
 
Genomic mRNA  primers of the gene bnip3 (BCL2 interacting protein 3) of species Danio rerio
Sub-sequence:  From To    Product range: MinimumMaximum        

Selected sub sequence
Target sequence length: 14055 Selected subsequence from: 1 to:700 Selected subsequence size:700
GTAGAGTTGGCTCAATCTGGCAACCCTTGTGCCAGGGTGCCAGTTTTGTTGTCTTTCTGTTTGCCCTATATTTCCATCCATAGGACAGCCGCATGTTGCGTCACCACCAGCTGTGTGGAT
TCATGGAATAAAGATCCCGAACCAATTCTGTCACATGAATCCACATGCGGTTTATTGTGCTGGACGTGCAGAATATATCTAACAGAGCGCTGTCTCATCGACAAACACCTCGTTTTACTC
GTGGGGCGACCCATGTCTCTGGATAACACTGCGTTTCTGTATCTATCGACTGAATTTTTAAGGATTTAAACGGAGGTGAATCGTCCTTTTGTTGGTGAAAGAAACAAAAATGTCGATTGA
AAAGCACAGCGTGTCTGAAGAAAACCTTCAGGGTATGTAGATATCAAAACAACTCCGGTTAACGCTCGTTTTGTGCATGTTTCTCCTCTAAAACGCACATTGTTACCATGTAAATGCATG
TTTGGGGAATATTTACAGTTACATACGTATATTAAACGATGTTCTTTCACCTTAGTCTTTTATATTAATATTTGACAAGATGAAGCAGGTGTGTGTGTGTGTGTGTGTGTGTGTGTACAA
ACCACAAAAATGACGCATGTGATCCGCAATAATAAACACAGACGCGAAGCAAACTCTGAATCGTTAATGAATCATTCTTCGGAGTCGGATCTTTTAAACA

Primers information
S.No.Primers SequencesStartLengthTm GC %Product size
1Forward primer

Reverse primer

ATCCATAGGACAGCCGCATG

GTTTGCTTCGCGTCTGTGTT

75

653

20

20

59.964

59.972

55.000

50.000

579 bp
2Forward primer

Reverse primer

CATCCATAGGACAGCCGCAT

TCAGAGTTTGCTTCGCGTCT

74

658

20

20

59.964

59.968

55.000

50.000

585 bp
3Forward primer

Reverse primer

ATCCATAGGACAGCCGCATG

TCAGAGTTTGCTTCGCGTCT

75

658

20

20

59.964

59.968

55.000

50.000

584 bp
4Forward primer

Reverse primer

CATCCATAGGACAGCCGCAT

GTTTGCTTCGCGTCTGTGTT

74

653

20

20

59.964

59.972

55.000

50.000

580 bp
5Forward primer

Reverse primer

ATCCATAGGACAGCCGCATG

ACACACACACACCTGCTTCA

75

579

20

20

59.964

60.036

55.000

50.000

505 bp


Home  CABin  Support &Feedback
Copyright ©2016 NBFGR (ICAR), All Rights Reserved