A resource on hypoxia responsive genes in fish
 
  Primer design
 
Genomic mRNA  primers of the gene LOC114142880 (ferritin, heavy subunit) of species Xiphophorus couchianus
Sub-sequence:  From To    Product range: MinimumMaximum        

Selected sub sequence
Target sequence length: 2115 Selected subsequence from: 1 to:700 Selected subsequence size:700
GACTTTCCGCACGTAGCGCACACAGTTGATCCTCGTTAGCGGACAGTGAAGGTTACCTGCTTCAACAGTGCTTGAACGGCAACCTTTTAACTGTCTCAACAGTCAAATAGCAGCTTCTCT
TCAGCTTTTTTTTGTCAAGCAACTCGAACTTTAGTGCCAGCTAGCTAAATTATCCTCCATCGCGCTTTGCTAGAGGGCTATTTGTCTTGCTAACAACGCAACCAGTCGAAGAGCGGCGAC
CTCCTCAAAAGACGACCGAACTACAGTAAGGAGTGATATGCGTTATGTAATTTTCTTTTCTATGTATGTGTATTTGCGTTTATGTTAAAATGTTTTTTTTATAGGGGTTTAAGTTTTCAT
TTTCACCACAAAGACGCTGCTCATGTGGCATTTGGCACAAGAAGCGCTTTATGAGCTGGTAGCAGCTCATGGTGCTCAAAGCCTGGCTTTTTCCATGTAGTGTTTATATTAGCATCGAGG
TTGTTGTTTTTTTTAGTTATTATGAAGCGCCTTTAAGGGCTAGAGTCGGGTTGGTCATTATTGGAGTCAATTTTCAAAACTTCCGTATTTAAGTCCCTTGATATACGTGGGCATGAAGTT
ACAATTTCATGTTATTTTGACTGTAATTCGACTAAGTGTTTGTTTTTTTATTTTTTCAGAACCATGACTTCCCAGGTGAGACACAACTACCATCAGGACT

Primers information
S.No.Primers SequencesStartLengthTm GC %Product size
1Forward primer

Reverse primer

CCTCGTTAGCGGACAGTGAA

ATGACCAACCCGACTCTAGC

30

537

20

20

59.757

59.175

55.000

55.000

508 bp
2Forward primer

Reverse primer

GCGGACAGTGAAGGTTACCT

ATGACCAACCCGACTCTAGC

38

537

20

20

59.679

59.175

55.000

55.000

500 bp
3Forward primer

Reverse primer

ACGTAGCGCACACAGTTGAT

ATGACCAACCCGACTCTAGC

10

537

20

20

60.320

59.175

50.000

55.000

528 bp
4Forward primer

Reverse primer

CGTTAGCGGACAGTGAAGGT

ATGACCAACCCGACTCTAGC

33

537

20

20

60.039

59.175

55.000

55.000

505 bp
5Forward primer

Reverse primer

TCGTTAGCGGACAGTGAAGG

ATGACCAACCCGACTCTAGC

32

537

20

20

59.757

59.175

55.000

55.000

506 bp


Home  CABin  Support &Feedback
Copyright ©2016 NBFGR (ICAR), All Rights Reserved