A resource on hypoxia responsive genes in fish
 
  Primer design
 
Genomic mRNA  primers of the gene LOC111188216 (ferritin heavy chain-like) of species Astyanax mexicanus
Sub-sequence:  From To    Product range: MinimumMaximum        

Selected sub sequence
Target sequence length: 2221 Selected subsequence from: 1 to:700 Selected subsequence size:700
TCCTCTGATTTTGTTCTTACAGATGCAGTCTGTAGTTAAACACAACCTCCATTCAGAGAGTGAGGGAGCCATTAATAAGCTCATCAACATCAAGCTCACAGCGTCCTACACCTACTTGTC
TTTGGTATGTTTTTATGTCTCACTGACCCTCTTACTTTTTGTTCATTTCTCTACGTTTATTCTACGAAGCTGATTCAGTTGACCATTGCTTAAAACTTGTAGAAATTTGTGCTTCAGCTA
CTGTTCCCTGTTGGTCTCCCAGGGCATGTATTTTGACCGAGACGATGTGGCTCTGCCCAACTTCTCCAAATATTTTCTGGAGCGCTCTGTGAAGGAGAGGGAGCATGCTGAGCGTTTGCT
GGGGTATCAAAACATGAGAGGTGGAAGAGTTCTTCTTCAGACTATTGCGGTGAGTGTGGGTCCCGGTTTAAAGTCTTTTCTTCTGTGCAGGATCTTCTGCTTTGTCTTTATTATGTTGCC
AGCCCAGTGTTTCTCATTGCTCCAGTAATATTCCTATTTACACTTACAATAATCATAGAGCAGATAATGATAGAGAGCAAGGACACAGTGCAGAATCTAAGCACTGTTAATGTTTTTTGT
TTTTGTTTTTTTTTTGTTCTTCAACACTAAAAACCTTGTATCTTATTTTAATGTAAATCTGGCACATCTTTGTTTCAAAATTCAATGATTAATGCACCAG

Primers information
S.No.Primers SequencesStartLengthTm GC %Product size
1Forward primer

Reverse primer

TTCAGAGAGTGAGGGAGCCA

CTGCACTGTGTCCTTGCTCT

51

572

20

20

59.885

60.250

55.000

55.000

522 bp
2Forward primer

Reverse primer

TTCAGAGAGTGAGGGAGCCA

TCTGCACTGTGTCCTTGCTC

51

573

20

20

59.885

60.250

55.000

55.000

523 bp
3Forward primer

Reverse primer

TTCAGAGAGTGAGGGAGCCA

TGCACTGTGTCCTTGCTCTC

51

571

20

20

59.885

60.250

55.000

55.000

521 bp
4Forward primer

Reverse primer

TTCAGAGAGTGAGGGAGCCA

TTCTGCACTGTGTCCTTGCT

51

574

20

20

59.885

59.819

55.000

50.000

524 bp
5Forward primer

Reverse primer

TTCAGAGAGTGAGGGAGCCA

GCACTGTGTCCTTGCTCTCT

51

570

20

20

59.885

59.965

55.000

55.000

520 bp


Home  CABin  Support &Feedback
Copyright ©2016 NBFGR (ICAR), All Rights Reserved