A resource on hypoxia responsive genes in fish
 
  Primer design
 
Genomic mRNA  primers of the gene vegfa (vascular endothelial growth factor A) of species Austrofundulus limnaeus
Sub-sequence:  From To    Product range: MinimumMaximum        

Selected sub sequence
Target sequence length: 14780 Selected subsequence from: 1 to:700 Selected subsequence size:700
NGAATTCATTTATTATTATTTTTTGGACTGGATTTCCAACATCATGAACTTTATTGACAGTTTGACTCTACTATTTTTGACGCTGTCAGCTGTCAAGGTGAGTGTGTTACTGGGAGCAAA
ACTAAAAGGGGGAGGTGGGAAGGAAAGAAAACAAAACAAAACAGATCCATTGACCTTCATTTGTGGTCATTAATGTGCAGCTTGTCCTTGTCTCTCTCCTTCTAGGTCACCGTTCAGATC
AGATGTTTTGGTAGCTTTTTTTATTTCCTTTTAGTAGCTTTTACGCACAGGGAACAAGCGTCACGCCGCAAAGCCTTCCGCTCACAAGTGGTGCGTTTTGTTGTGTTTCGTTTTTTTTCT
TTTGCTCCAAATCAAGTAACTGTTTAAAGCACTTTAAGAGAACTAATGTTGTGAAGTTTGACGCGGACTGTGCAGGCCTTGGAGATATTATTACGCGTTAAAGGCGCAGTGGCTCCATTC
TGCATGGGTCAGGACATGTGAGCAGGTTCACCACTCTTTGCTTCCAATTTTTTTTTTCTTCTTCTCAACTTGAACTTCCAGTTTGAACATTTTTCATGAACCTGAACACATGCTGGTTCG
TTTTCAAGTGGCTGTTTGAGCCTGAAAATAATCATTAATGGAGCGGTGGTGGCAGCGCTTTGAGCAAAGGTTTTCAAGGTAACGCACCGTTCCAAGAGGT

Primers information
S.No.Primers SequencesStartLengthTm GC %Product size
1Forward primer

Reverse primer

TTTGACGCTGTCAGCTGTCA

AACCTTTGCTCAAAGCGCTG

75

671

20

20

60.179

59.969

50.000

50.000

597 bp
2Forward primer

Reverse primer

TTTGACGCTGTCAGCTGTCA

CGAACCAGCATGTGTTCAGG

75

599

20

20

60.179

59.481

50.000

55.000

525 bp
3Forward primer

Reverse primer

TGACGCTGTCAGCTGTCAAG

AACCTTTGCTCAAAGCGCTG

77

671

20

20

60.598

59.969

55.000

50.000

595 bp
4Forward primer

Reverse primer

AGCTGTCAAGGTGAGTGTGT

AACCTTTGCTCAAAGCGCTG

87

671

20

20

59.167

59.969

50.000

50.000

585 bp
5Forward primer

Reverse primer

ACTAAAAGGGGGAGGTGGGA

AACCTTTGCTCAAAGCGCTG

120

671

20

20

59.802

59.969

55.000

50.000

552 bp


Home  CABin  Support &Feedback
Copyright ©2016 NBFGR (ICAR), All Rights Reserved