A resource on hypoxia responsive genes in fish
 
  Primer design
 
Genomic mRNA  primers of the gene LOC103032190 (erythropoietin-like) of species Astyanax mexicanus
Sub-sequence:  From To    Product range: MinimumMaximum        

Selected sub sequence
Target sequence length: 21126 Selected subsequence from: 1 to:700 Selected subsequence size:700
AGCAGCGTGCAGCTAGGCAAAACAGTCGCATGGCTTTCAACAATGCACACCCTAAACATGCTAAACCTGGTTGCGAATGCCTTCAGTTTCTGGTAAGAATTGCTTTTTTCTCCTGCTGAT
GGGCTTACTTTGCATTTTTCTTTAAGGAATCTGGATTAAAAAAAATTATCATGCAAAAATAAAAAAACATAGAAATGTGTATTTAAAAGTAGGACAAGTGGGGTTCTGAAAAGGGTTTAA
TAAAAAAAATAAGCCTTGTTTTTTTGGTTTTACAGATATGCATATATACTCTGCATATAACTGGTCTTGTAAAACATGTGGCCATTATTAGGTGCACCTACTATTACCTTATTATCCCGC
TGAGTAAAGCGTGATACAGTAGACTGTAGGTCACCTGGTCACCAGTGTGTCAAGGACTGAAACTGTTCCCACGGAGAATGGCTAGCTCAAACTGTGCGTTTCCAATAAAATGTCCAGGAA
GTATTTCTTTAACTATGCAGGTCTTTATTTGACACACACGCTTAGCATCACAGCTTAATTACACCATGACCATAGAGCTACAGTTCTCTCCAAAAGCATTGGAGCAGTGAGGTCAATCCC
TTTTATTCTGCTGTAGACTGAGAACATTTGAAATTGACATTAAAGAATGACACAAAAGATGACACAAAAGATCCCCATTTTAGTTTTTATTTCCACGTAT

Primers information
S.No.Primers SequencesStartLengthTm GC %Product size
1Forward primer

Reverse primer

CAGCTAGGCAAAACAGTCGC

AGCTGTGATGCTAAGCGTGT

9

534

20

20

59.833

60.037

55.000

50.000

526 bp
2Forward primer

Reverse primer

CGTGCAGCTAGGCAAAACAG

GACCTCACTGCTCCAATGCT

5

593

20

20

60.110

60.036

55.000

55.000

589 bp
3Forward primer

Reverse primer

CAGCTAGGCAAAACAGTCGC

GACCTCACTGCTCCAATGCT

9

593

20

20

59.833

60.036

55.000

55.000

585 bp
4Forward primer

Reverse primer

GCAGCTAGGCAAAACAGTCG

GACCTCACTGCTCCAATGCT

8

593

20

20

59.833

60.036

55.000

55.000

586 bp
5Forward primer

Reverse primer

CGTGCAGCTAGGCAAAACAG

AGCTGTGATGCTAAGCGTGT

5

534

20

20

60.110

60.037

55.000

50.000

530 bp


Home  CABin  Support &Feedback
Copyright ©2016 NBFGR (ICAR), All Rights Reserved