A resource on hypoxia responsive genes in fish
 
  Primer design
 
Genomic mRNA  primers of the gene arnt2 (aryl hydrocarbon receptor nuclear translocator 2) of species Astyanax mexicanus
Sub-sequence:  From To    Product range: MinimumMaximum        

Selected sub sequence
Target sequence length: 155022 Selected subsequence from: 1 to:700 Selected subsequence size:700
GGGCGCGCGGTAATGTATGCAGGCTGAAGTCTCGCGGTGTTTCCGCACCTTTCAGACATCTTGCGTTATTTTTTCTGTAGCGAAGCTCCGCAGCAGCAGAGCCAGGGCTCCGTACAGCAG
GGCGGCACGGCCATCAACCCACACAGCCCGCGGTAAACACCCGCCCGCCCCTCCTACACCCTCCGCCCCGCGATCGGGCGGCTCGAGCTGCTGGCCCGGAGCTCGCCACTCGCTGCGTGC
GTCACCACCGTCCAGATCCCCGGGCTTACCGACGCCGCCGCCGCCGCTGCTGTTATTATTGTTGTGTCCGTTTTTCTCCGGCGAGCAGCGGAGCATGGCGACCCCCGCCGCGGTGAACCC
CTCCGGTAAGTCTGATCTTTGATTATCGAGGGTTTGATCGGGGGAGACTGGCTCCGGTGCTCCTGCGCGAGTGACGTTTTCCCGGTAACAAAAGAAAGGATCGGTGGGTGAAGAGGGAGC
ATCACCCCTCCTCCTCCTCCTCCTGTTTCTCCTCCTGCTCCTGATCCTTCATCACCTCCTCTTCCTCGCTGTGCCAGCCCTGCTTTAACATCCACACTAACACCAGCTGATCACTGCTCT
CACAGGCTCTGAGCTGATCTTTAATGGTTGGTAAGCTGATTATCCAGAGGAGAACGTTCCCTGTACTGGTAAGCTTGGCTAGATGGTTAACCAGGTCTGA

Primers information
S.No.Primers SequencesStartLengthTm GC %Product size
1Forward primer

Reverse primer

TATGCAGGCTGAAGTCTCGC

GGATCAGGAGCAGGAGGAGA

15

526

20

20

60.179

60.106

55.000

60.000

512 bp
2Forward primer

Reverse primer

TATGCAGGCTGAAGTCTCGC

AGCGAGGAAGAGGAGGTGAT

15

549

20

20

60.179

60.033

55.000

55.000

535 bp
3Forward primer

Reverse primer

TATGCAGGCTGAAGTCTCGC

GAGCAGTGATCAGCTGGTGT

15

598

20

20

60.179

60.037

55.000

55.000

584 bp
4Forward primer

Reverse primer

TATGCAGGCTGAAGTCTCGC

AGGATCAGGAGCAGGAGGAG

15

527

20

20

60.179

60.106

55.000

60.000

513 bp
5Forward primer

Reverse primer

TATGCAGGCTGAAGTCTCGC

GCGAGGAAGAGGAGGTGATG

15

548

20

20

60.179

59.896

55.000

60.000

534 bp


Home  CABin  Support &Feedback
Copyright ©2016 NBFGR (ICAR), All Rights Reserved