A resource on hypoxia responsive genes in fish
 
  Primer design
 
Genomic mRNA  primers of the gene LOC103027723 (peroxisome proliferator-activated receptor alpha) of species Astyanax mexicanus
Sub-sequence:  From To    Product range: MinimumMaximum        

Selected sub sequence
Target sequence length: 26322 Selected subsequence from: 1 to:700 Selected subsequence size:700
GATTATCGGGGGGTTTTGAAAGCAGTGTCGGGGGCGGGGTAGGGTACAGGAGGGTTTAGGATGGGGTTAAACCCGGTCTCTGGAGGTGCATCGCTAGAGCCTGGACTCGGCCAACTTCAC
TCAGGTAGCGCCAAACTTGGCTGATATATAACTACTAATACAGAACAGCGCAGCTAAACTAACTGAGCACAGCTTTATGCTTTACACTTTCATGGTGAAGCCTTTTAACAAAGTTATGTA
CAAATAATTTGTTTATTTAAAAAAAGCAGCGACTAATAAATGTAAAATTGATAGAATAAAGAGATATTGGCCCTGAGACTTTCATATGTAACGTTACACTGTTATACCATATAGACAGAG
TGTATAAGGTGATTCTGCCAATCAAAATAATAAAAATTAAGTGATGTAAGATTTCCTATTCAAAATAGTCTAGTTTTGTTTAGGCAGCTGTACCTATAAAATTGGTCATTCTACAGAAAC
ATACTCTTTTGGAACGGCAAGTTGACCTACATTTTCAGAAAAGCATGATATTTACATCACTGGCATCATTTTGGCATCTTTCACATAATTGTGAATTGTGCGTGCAGTGCACCATGCCCA
CTGTCATGTTTGGAATAGTAACCTATATATGGCTAAATGAAAAAAGACTAACATAGCTAAATTGGTGGCTCAAGAAGTGTTTGTTAGAATCATTAAAATA

Primers information
S.No.Primers SequencesStartLengthTm GC %Product size
1Forward primer

Reverse primer

CTCTGGAGGTGCATCGCTAG

AACATGACAGTGGGCATGGT

77

609

20

20

59.968

59.887

60.000

50.000

533 bp
2Forward primer

Reverse primer

CTGGAGGTGCATCGCTAGAG

CACTGCACGCACAATTCACA

79

588

20

20

59.968

59.971

60.000

50.000

510 bp
3Forward primer

Reverse primer

CTCTGGAGGTGCATCGCTAG

CACTGCACGCACAATTCACA

77

588

20

20

59.968

59.971

60.000

50.000

512 bp
4Forward primer

Reverse primer

CTGGAGGTGCATCGCTAGAG

AACATGACAGTGGGCATGGT

79

609

20

20

59.968

59.887

60.000

50.000

531 bp
5Forward primer

Reverse primer

GGGTAGGGTACAGGAGGGTT

CACTGCACGCACAATTCACA

36

588

20

20

59.956

59.971

60.000

50.000

553 bp


Home  CABin  Support &Feedback
Copyright ©2016 NBFGR (ICAR), All Rights Reserved