A resource on hypoxia responsive genes in fish
 
  Primer design
 
Genomic mRNA  primers of the gene flt1 (fms related tyrosine kinase 1) of species Takifugu rubripes
Sub-sequence:  From To    Product range: MinimumMaximum        

Selected sub sequence
Target sequence length: 21119 Selected subsequence from: 1 to:700 Selected subsequence size:700
TTCCTTAAAAAGTTGCTTTTACGCACTGTGGGTGTGTCGATGGTCGTTACGGAAATCCGACATCCGGTAGCCGCAGTGTGGGAACGCTATAAATTCGCCCGCCGTCCCGAAAACGCTGGG
AAAAAGTTGCAGTGGAGTCGAGGCGCACTGTCCTGTTGCGTAATCTCCTGCAAGCTTCACCATCACCAGGAGAGCAGGCGTCTGGGTTCGGCCTTCCTGCACAGAAGCGCGCTGCCTTCA
GTCCGGAGAGCGAAACGGAGCAGGATTAAAAGTTGATTTCGTGTTGACATTTTAAAGCATCGGAGCCGCCAGACATGATGAATTTTTTGCTTTTCTGCCTGCTGTGTGGATTGTACGGCG
TCTTTGGAAAAGGTGAGTAAAAACCGGTTGAACACCTGGTTTTCCCATTTTTGCCACCTTTTATGTCAAACATCTTTTCATGTAAATATTTAAATAAATGTTTAAAAAAAAAATAGACTT
TTCCATGAATAAGTACGCATTTTCCATCACCACTGTGCACAATTGTCAACAACCCAAAAGACGAATATTCTGTTCTCGCGGTGCCGATTTTGTGGTGAATTACTCTGCTGCTGTCACGTG
TCTGCGGTTGTAGACCTTATTAACACCGCGCGCGGTGGAGGAGATAAGCTCCATCCTGCGGAACGTGTGTTTGGATATCGCGGACCTCTGCGGCCAGGCT

Primers information
S.No.Primers SequencesStartLengthTm GC %Product size
1Forward primer

Reverse primer

GTGTCGATGGTCGTTACGGA

CACGTGACAGCAGCAGAGTA

33

599

20

20

59.831

60.039

55.000

55.000

567 bp
2Forward primer

Reverse primer

GCTTTTACGCACTGTGGGTG

CACGTGACAGCAGCAGAGTA

14

599

20

20

60.040

60.039

55.000

55.000

586 bp
3Forward primer

Reverse primer

CGCAGTGTGGGAACGCTATA

GAGCTTATCTCCTCCACCGC

71

650

20

20

60.179

59.967

55.000

60.000

580 bp
4Forward primer

Reverse primer

TGTGTCGATGGTCGTTACGG

CACGTGACAGCAGCAGAGTA

32

599

20

20

60.110

60.039

55.000

55.000

568 bp
5Forward primer

Reverse primer

AAGTTGCAGTGGAGTCGAGG

GAGCTTATCTCCTCCACCGC

123

650

20

20

59.966

59.967

55.000

60.000

528 bp


Home  CABin  Support &Feedback
Copyright ©2016 NBFGR (ICAR), All Rights Reserved