A resource on hypoxia responsive genes in fish
 
  Primer design
 
Genomic mRNA  primers of the gene arnt2 (aryl hydrocarbon receptor nuclear translocator 2) of species Takifugu rubripes
Sub-sequence:  From To    Product range: MinimumMaximum        

Selected sub sequence
Target sequence length: 38411 Selected subsequence from: 1 to:700 Selected subsequence size:700
ATAATAATTTATTCAAGTAACCCTAAATCTCGCGGTGCTACCATTCAGACATCTTGCATTTAATTAGAGCTTCACTTGGAGGGTTTTTCCTTTTCAACATACATGCACAGTTTCTCCATG
TTTTGAGGAAAAAAGCAACATTTATTCAAAGCCAGAATTTAGGTTACATGTCCTTTGTTTTAACGACAACGAGGCTGTTGTACCGACCGTCGCCTGCCAATCAACCCCCCGACATTAGAC
CGTATCTAGCGGGGCTGCTTCGTCGTATTGTGGACTATTTCCATCGCTGCGGCTTTATTTCCCTACGTTGAAAGGATGGCAACCCCCGCTGCCGTCAACCCATCGGGTAAGTAAATCCCT
CCTGTAACGTTACGAGGCAAAATGAGCGCTGAAAAAGACATAATGGTAAAGTAGCTGATATTTTTTTCGACGCTTGCCGAAGATGGCTGTCCCGACAGGCCGATGAAGCCTCGCCAGAGC
GTCCATCCCCCTTCCCCCTCCGACCTGCTCTTAACGCTGCCCTAGTAACGTTTTCGTGGCTGGCATCTTTTGCTGAATGCTATAAGGTCTTCGCTACATTGATATGACAGTGATCCACTT
TTACCTTGGCGATCTGCGTTATAATTACTCATATCAAAGCTATTTCGCATCTGCTCAATCATATACGAACATTACTTGCCAAATGTATTGGGGGTGTTGA

Primers information
S.No.Primers SequencesStartLengthTm GC %Product size
1Forward primer

Reverse primer

ATCTCGCGGTGCTACCATTC

ACGCAGATCGCCAAGGTAAA

26

618

20

20

60.249

60.037

55.000

50.000

593 bp
2Forward primer

Reverse primer

AATCTCGCGGTGCTACCATT

ACGCAGATCGCCAAGGTAAA

25

618

20

20

59.822

60.037

50.000

50.000

594 bp
3Forward primer

Reverse primer

AAATCTCGCGGTGCTACCAT

ACGCAGATCGCCAAGGTAAA

24

618

20

20

59.822

60.037

50.000

50.000

595 bp
4Forward primer

Reverse primer

AAATCTCGCGGTGCTACCAT

AACGCAGATCGCCAAGGTAA

24

619

20

20

59.822

60.037

50.000

50.000

596 bp
5Forward primer

Reverse primer

AATCTCGCGGTGCTACCATT

AACGCAGATCGCCAAGGTAA

25

619

20

20

59.822

60.037

50.000

50.000

595 bp


Home  CABin  Support &Feedback
Copyright ©2016 NBFGR (ICAR), All Rights Reserved